Anslem, Meditation on Human Redemption Essay Example | Topics and Well Written Essays - 250 words

Anslem, Meditation on Human Redemption - Essay Example He says that people should not blame The Lord after deceiving themselves regarding his truth yet has only trusted in the falsehood of himself. This he says is because The Lord remains in truth in every respect so that He can do what has to be done in each aspect and respect, and that is why The Lord became Incarnate2. An interesting feature is the fact that The Lord has given man will and power to choose between right and wrong and does not compel him. He just tries to convince him o obey using various aspects like giving up his only son to die and suffer for redemption of man as well as to serve as a true example of obedience. He says that the life of Jesus is more precious than every other thing on earth and by giving it up for redemption of the soul of man, He really wanted the redemption of the soul of man3. Jesus himself gave u his own life as an example to man that they are obliged to God even if it means they have to give up their own life as a proof of obedience to him. It is also shown that God has given man the power of will, by allowing him to d o whatever he wants. This he gives as an example that God allows the devil to tempt man and man has the right to refuse or accept but whatever man does, He must remember that He is answerable to God and not the devil. This shows that The Lord h as supreme power over man, and He should give his soul to Him. When man sins, he only is punished by God and the devil is not since he as man has sinned against The Lord and the devil has not. Therefore, satisfaction to God is not given by doing things said by God only, but by giving God something of his own which is not of God which exceeds all other things this is called sacrifice. To sin is to dishonor God and man should not dishonor God; however, necessary it looks. Therefore, a sinner ought to give the Lord something greater than dishonor to God and that is only by honoring Him. His son,

The scientific study of behaviour and mental processes Essay Example for Free

The scientific study of behaviour and mental processes Essay For example, a person who feels the need for sex but who has been told by their parents that sex is wrong may suppress this tendency. In order to receive positive regard from their parents they abide by this statement. In this way the person has received conditional positive regard from the parents. However, the need for sex remains, as this is an organismic value, which Rogers describes as our inborn set of values, possessed by all (Medcof Roth, 1979). When these needs are suppressed, Rogers sees neurotic and psychotic problems developing (Hays Orrell, 1987). Abraham Maslow believed that the way towards self-actualisation was to fulfil certain needs. These needs he arranged into a pyramid, which he referred to as the hierarchy of needs. Starting with simple needs, for example, hunger and thirst and then progressing upwards to security, belonging, esteem, understanding and aesthetic needs before reaching self actualisation (Rungapadiachy, 1999). Maslows theory appeared logical and optimistic and became very popular without much criticism. It became popular within business seminars as a training aid. However Maslows hierarchy of needs has not been supported by research. Hungry people may still seek esteem from others and a person who has satisfied their hunger may not necessarily seek higher needs (Wade Tarvis, 1993). Wade Tarvis (1993) also suggest that each person develops their own individual hierarchy from childhood to old age and although for some, the need for love and security will dominate, for others the need for power or achievement will rule. Both Maslow and Rogers believed that given the right conditions, Maslows satisfaction of basic needs and Rogers unconditional positive regard, people will naturally choose growth enhancing alternatives (Roth, 1979). The behaviourist approach arose as a backlash of other approaches at the time and rather than looking at the internal factors, behaviourism shifted its emphasis to the external factors. Psychologist John. B. Watson was becoming disenchanted with the attempts to study emotions, motives and thoughts as these were often vague and subjective and difficult to systematically study. Watson argued that psychology must be based on what is observable and measurable by more than one person (Gross, 1996). Watson believed that behaviour could be seen as a set of reactions in response to stimuli. In this way, if one knew the stimulus then they could obtain the desired behaviour. The two types of learning which behaviourists concern themselves with are classical conditioning and operant conditioning (Rungapadiachy, 1999). Classical conditioning refers to a behaviour that is reflexive or involuntary, for example, coughing, sneezing, shivering, sexual arousal (Rungapadiachy, 1999). Watson and Rayner (1920) conducted experiments into classical conditioning by establishing a rat phobia into an eleven-month-old child. The child was introduced to a white rat to play with and the child was pleased. However, a steel bar was introduced and whenever the rat was given to the child and the child reached out for the rat the steel bar would be struck to create a noise and frightening the child. Eventually on introduction of the rat without the steel bar the child would become frightened of the rat. Watson and Rayner had succeeded in creating a conditioned response (Wade Tarvis, 1993).

Interpretations of Slavery Essay -- Slavery Essays

Interpretations of Slavery INTRODUCTION Slavery is known to have existed as early as the 18th century B.C. during the Shang Dynasty of China. Slavery was widely practiced in many other countries, including, Korea, India, Greece, Mexico and Africa. (Britannica 288-89). When most people consider slavery, however, they think of Western slavery in North America because it is well documented and it was such a horrible institution. Even though there is no one definition of slavery, the people who study it (historians, anthropologists and sociologists) agree that certain characteristics are present in all forms of slavery. Slaves were property and objects, not subjects of the law. Slaves had few rights, always fewer than their owners. Slave were also limited to few social activities and were not allowed to participate in political decisions. Finally, any earnings aquired by slaves by law belonged to their master. Also, slaves were prevented from making their own choices regarding physical reproduction. Western slavery took each o f these slave characteristics to a new level and as a result there are many authors who wrote about the evil institution of slavery in the Colonies. American literature is full of authors who describe, condone or oppose slavery, the most informative and influential of whom were Black writers because many were able to give a personal perspective on slavery. These Black writers had to struggle to be accepted as literary writers before they could get their message across. "The tradition of black writing in the United States is, in many ways, a history of attempts at literary liberation from racism-attempts to articulate in a specifically black context the characteristic American themes of freedom and self-determ... ...d by Henry Louis Gates, Jr., Penguin Group Publishing, New York, 1987. Costanzo, Angelo. Surprizing Narrative, Olaudah Equiano and the Beginnings of the Black Autobiography, New York: Greenwood Press, 1987. Douglass, Frederick. Narrative of the Life of Frederick Douglass, Edited by Henry Louis Gates, Jr., Penguin Group Publishing, New York, 1987. Equiano, Olaudah. The Interesting Narrative of the Life of Olaudah Equiano or Gustavus Vassa, the African, Edited by Henry Louis Gates, Jr., Penguin Group Publishing, New York, 1987. Hughes, Langston, Milton Meltzon. A Pictorial History of the Negro and America, New York: Crown, 1968. O'Neale Sondra. "Olaudah Equiano," Dictionary of Literary Biography, American Writers of the Early Republic, ed. Emory Elliot. Vol 37. Princeton: Bruccoli, Clark and Layman Book, 1985. "Slavery." The New Encyclopedia Britannica. 1995 ed.

The Continuing Importance of Affirmative Action Essay -- Argumentative

The Continuing Importance of Affirmative Action    Affirmative action is about to take quite a beating. Prominent Republicans from Phil Gramm to Pete Wilson to Bob Dole all plan on making the attack on affirmative action a central plank of their campaign rhetoric. The Clinton administration, perhaps trying to stem the attack before it begins, recently announced that it would reevaluate the merit of all affirmative action programs. And many of those to the left of Clinton oppose affirmative action--albeit probably for different reasons than those to his right. Considering the overwhelming opposition to affirmative action, it seems improbable that affirmative action would have much to recommend it. Yet this contention deserves examination. There are a large number of factors contributing to a given policy's favorability; it seems unlikely that all aspects of affirmative action, from morality to reality to the gray in between, count as strikes against it. Concerns over fairness to white males seem to be at the root of most opposition to affirmative action. This argument is difficult to counter; it seems clear that affirmative action does amount, strictly speaking, to reverse discrimination. For some, this fact alone is enough reason to ring the policy death knell. Yet this conclusion seems to me hasty. If affirmative action hurts white males only a little, yet helps minorities and women significantly, then we might well decide to keep affirmative action around, despite its unfairness. Private universities commonly employ policies of preference which are sometimes euphemistically termed "development policies." Development means that there is a concerted effort on the part of admissions officers to admit students who come fro... ...(If you are unconvinced of this point, do a bit more reading and thinking.) More than lowering the hiring and admissions standard by which minorities and women are measured, affirmative action works to counteract pervasive racism. If an employer harbors racist, heterocentrist, or sexist views, then being forced to take a second look at minorities and women may counteract that prejudice. Affirmative action, then, may have less to do with lowering the standard by which minorities and women are measured, and more to do with equalizing opportunities given. That sounds to me like sound policy even Newt would find difficult to oppose--policies designed to ensure equality of opportunity. For as long as it has been policy, affirmative action has been implemented with an eye towards equalizing opportunity. A more admirable, mainstream ideal is difficult for me to envision.

A Common Swot Analysis of Unilever and P & G Essay

Common Strengths The strong branding of the two companies make them one of the most successful brands in the world. Extensive experience in marketing in different market segments and is two of the best marketers in the world. Known for its diverse brand portfolio. The companies are able to customize their global products and brands according to the local preferences. Significant scales of scope and economies in their operations Access to global resources and synergy of resources and operations Common Opportunities Usage of online social networks and internet marketing techniques. Rise in purchasing power and population in developing countries (China, Indonesia, Thailand-these markets are less saturated and less competitive) Increasing need for healthy products due to better consumer awareness THREATS There is a cut throat competition in the fast moving consumer’s goods markets today The other competitors are making their product portfolios diverse day by day and using different marketing and promotional strategies to increase their market share. In the market many substitutes are available for products at cheaper prices. This is specially affecting the strategy of P & G Due to recession, the consumer spending has decreased globally. Also, the prices for raw materials are increasing so cost to the company is increasing. Government interventions in developing markets WEAKNESSES The large scale operations of the two companies make the cultures heavy and processes slow. This also leads to quality control problems. Complex organizational structures (dealerships with many associates, joint ventures and agency relationships) Lack of direct connection with ultimate consumers due to dependence on retailers and wholesalers(in Western countries retail giants such as Tesco, Asda and Sainsbury are very strong and have the ability to dictate big multinational companies). Inefficient management of brands (being unable differentiate between stars,cashcows and dogs according to Mandelow’ s Matrix eg-25 brands of Unilever account for 73% of global sales and about half of P&G’s sales come from its top ten brands)

Chart of Common Charges of Chemical Elements

Chart of Common Charges of Chemical Elements This is a chart of the most  common charges for atoms of the chemical elements. You can use this chart to predict whether or not an atom can bond with another atom. The charge on an atom is related to its valence electrons or oxidation state. An atom of an element is most stable when its outer electron shell is completely filled or half-filled. The most common charges are based on maximum stability for the atom. However, other charges are possible. For example, hydrogen sometimes has a charge of zero or (less commonly) -1. Although noble gas atoms almost always carry a charge of zero, these elements do form compounds, which means they can gain or lose electrons and carry a charge. Table of Common Element Charges Number Element Charge 1 hydrogen 1+ 2 helium 0 3 lithium 1+ 4 beryllium 2+ 5 boron 3-, 3+ 6 carbon 4+ 7 nitrogen 3- 8 oxygen 2- 9 fluorine 1- 10 neon 0 11 sodium 1+ 12 magnesium 2+ 13 aluminum 3+ 14 silicon 4+, 4- 15 phosphorus 5+, 3+, 3- 16 sulfur 2-, 2+, 4+, 6+ 17 chlorine 1- 18 argon 0 19 potassium 1+ 20 calcium 2+ 21 scandium 3+ 22 titanium 4+, 3+ 23 vanadium 2+, 3+, 4+, 5+ 24 chromium 2+, 3+, 6+ 25 manganese 2+, 4+, 7+ 26 iron 2+, 3+ 27 cobalt 2+, 3+ 28 nickel 2+ 29 copper 1+, 2+ 30 zinc 2+ 31 gallium 3+ 32 germanium 4-, 2+, 4+ 33 arsenic 3-, 3+, 5+ 34 selenium 2-, 4+, 6+ 35 bromine 1-, 1+, 5+ 36 krypton 0 37 rubidium 1+ 38 strontium 2+ 39 yttrium 3+ 40 zirconium 4+ 41 niobium 3+, 5+ 42 molybdenum 3+, 6+ 43 technetium 6+ 44 ruthenium 3+, 4+, 8+ 45 rhodium 4+ 46 palladium 2+, 4+ 47 silver 1+ 48 cadmium 2+ 49 indium 3+ 50 tin 2+, 4+ 51 antimony 3-, 3+, 5+ 52 tellurium 2-, 4+, 6+ 53 iodine 1- 54 xenon 0 55 cesium 1+ 56 barium 2+ 57 lanthanum 3+ 58 cerium 3+, 4+ 59 praseodymium 3+ 60 neodymium 3+, 4+ 61 promethium 3+ 62 samarium 3+ 63 europium 3+ 64 gadolinium 3+ 65 terbium 3+, 4+ 66 dysprosium 3+ 67 holmium 3+ 68 erbium 3+ 69 thulium 3+ 70 ytterbium 3+ 71 lutetium 3+ 72 hafnium 4+ 73 tantalum 5+ 74 tungsten 6+ 75 rhenium 2+, 4+, 6+, 7+ 76 osmium 3+, 4+, 6+, 8+ 77 iridium 3+, 4+, 6+ 78 platinum 2+, 4+, 6+ 79 gold 1+, 2+, 3+ 80 mercury 1+, 2+ 81 thallium 1+, 3+ 82 lead 2+, 4+ 83 bismuth 3+ 84 polonium 2+, 4+ 85 astatine ? 86 radon 0 87 francium ? 88 radium 2+ 89 actinium 3+ 90 thorium 4+ 91 protactinium 5+ 92 uranium 3+, 4+, 6+

Japanese versus American Innovation Strategies essays

Japanese versus American Innovation Strategies essays Both Japanese and American firms have capitalized upon the use of innovative forms of technology and have changed the way the world does business. This is embodied in the creation of the wildly popular Toyota Prius as well as the ubiquity of Microsoft Windows on almost every computer screen around the world. However, although examples of successful American and Japanese firms are easy to find, both countries have radically different corporate cultures. America has a business culture of entrepreneurship and individually-generated innovation, while Japanese stresses the value of having stable corporate institutions that hone talent in a collaborative fashion. Americas core innovative advantage is in deploying entrepreneurship funded through the strategic use of venture capital. Entrepreneurs profit by taking risks like Bill Gates, who made the decision to drop out of Harvard and begin a company in his garage, the company that became Microsoft. But Japanese companies, like Toyota, stress continuous improvement-creating a bureaucratic system that sets benchmarks, and then tries to improve upon those benchmarks and eliminate defects. The American dream is to start ones own business, and to be independent of a corporate clock and a boss in a grey flannel suit. The Japanese dream to get into an elite university, and to use that degree to become part of a great company for the duration of ones working life. American companies, to make things better, stress radical innovation, redefining the market, and developing new technology to create efficiency. In contrast, Japanese companies emphasize evolution, and using teams and workgroups to create innovative solutions that generate value for the company and the consumer. Rather than creating completely new technology, Japan has often radically improved upon existing technology, such as Japans improvement of the American automobile industrys manufactur...

What is the Average Salary by Age in the United States

What is the Average Salary by Age in the United States What is the average salary by age in the United States? How much do people your age typically make? Are you above, below, or at the average percentile? According to the study conducted by CreditRepair.com, age does have a correlation to earning potential. The  average salary by age is highest for people ages 35-44, followed by ages 45-54. However, age is not the only factor that determines salary. The data below suggests that race is the largest factor in determining how much money you make, followed by gender. In 3 out of 5 age groups, Asians outperform all other races. Conversely, men outperform women in every age group.This suggests age  definitely plays a role but it is often influenced by other factors.That being said, let’s take a further look at how age, race, gender play a role in determining salary potentialSource: [BusinessInsider]

The Solar System and Moon Landing Assignment Example | Topics and Well Written Essays - 750 words

The Solar System and Moon Landing - Assignment Example The researcher states that people’s understanding of the solar system has changed significantly over the years. This is attributed to the several new scientific discoveries that have changed what we initially knew about the solar system. The Ptolemaic Theory initially made people believe that the earth was the universe’s center around which all other objects orbited. Because of the theory, the ancient Greeks counted the sun and the moon together with Mercury, Venus, Mars, Jupiter, and Saturn as planets. In this regard, they excluded the earth as a planet based on the belief that the earth was the universe’s center around which everything on space revolved. However, this belief changed later in the 17th century through the Copernican Revolution, when astronomers discovered that the sun is the universe’s center around which all planets revolved including the earth. The discovery also showed that the Moon is not a planet, rather a satellite of the Earth. Few years later, astronauts added Uranus and Neptune as planets. As a result, people were made to believe that only eight planets exist that revolves around the sun. Pluto was discovered later on in 1930 as the ninth planet revolving around the sun. Pluto according to astronomers is much smaller than Mercury or planetary moons. Telescopic findings showed that Pluto is not similar to the planets discovered earlier. As more discoveries became of Pluto, astronomers questioned whether Pluto should be regarded as a planet or not. (Cain, 2008). Even though, Pluto maintained its status as a planet through to the 1980s, things began changing in 1990s when astronomers, through telescopic observation discovered numerous icy worlds revolving the sun in around Neptune called the Kuiper Belt. With the discovery of Kuiper Belt and several icy bodies, scientists began to think Pluto as a KBO. Later on in 2005, scientists made a pronouncement that a tenth planet had been discovered. This has left peopl e wondering as to what planet means. Certainly, the new discoveries have changed significantly, what we initially knew as the solar system. In fact, as more discoveries continue to emerge, people’s understanding of what constitutes the solar system will continue to change (Cain, 2008). The Moon landing The Moon landing on July 20, 1969 is a classical historical event that has changed the scientific understanding of the moon in entirety. It marked the first ever moon landing that placed America in the lead in terms of technological advancements. The event took the Soviet Union by surprise as they watched in disarray the American astronauts placing the American flag on the moon’s surface. According to research, the event gave America the prestige that it lacked prior to this historical event (Spillius, 2009). The moon landing of 1969 has had a lasting impact on people’s scientific understanding for a number of reasons. For instance, America’s technology has significantly advanced due to the landing. In addition, not only does America have numerous microwaves, codeless vacuum cleaners,

Supply Chain Essay Example | Topics and Well Written Essays - 5250 words

Supply Chain - Essay Example II. Options of recommendation of a supply chain strategy: Keiretsu network The business will utilize the keiretsu network for the power tool company. Keiretsu is a network of organizations linked together by having a stake in each other's organization. The structure is usually likened to a spider's web and was designed to diffuse the adversarial relationship between buyer and supplier. The supplier also becomes a stakeholder of the organization and this set up induces the parties to work for their mutual benefit. This kind of relationship promotes cooperation and collaboration as each organization becomes a stakeholder in each other's organization whereby all stakeholders will share the fruit of profit or in the case of loss, also a share in the financial setback (Miyashia and Russel, 1994). The parts needed for the power tools (electric drills, saws, and sanders) are highly specialized and costly. It has a high learning curve and cannot be procured with any supplier overnight becaus e its specifications must be met before it can purchase from a certain supplier. Needless to say, a collaborative long-term and non-antagonistic relationship with suppliers is favorable for the company due to the requirements of its parts. The keiretsu procurement network serves this purpose. This kind of procurement strategy is aligned with the company's vision of producing the highest quality for its power tool because the company will be working close with its suppliers. Keiretsu is basically a collaborative supplier-client networking where each player has a stake in each other and this kind of supplier chain relationship serves this purpose. Power tools depend on the quality, timeliness and reasonability of the cost of its parts and it is imperative that the supplier that provides the parts of the power tools is committed to delivering its supplies according to those requirements. Of all the supply chain strategies, keiretsu network is the best option that serves the company's o bjectives. The best way to commit suppliers to provide supplies of quality, timely and cost effective is to build a relationship with them whereby the company can work with the supplier on how to better achieve these business objectives. This will not only produce better power tool products, but also allow better prices making the company more competitive in the market making keiretsu a top choice. The only downside of keiretsu network is that if a non-performing (tardy on delivery) and substandard (not meeting specifications) supplier is wrongly chosen, it would be difficult shake it off because the company has committed itself on a long-term basis, especially if there is a contract between the two parties. These issues can be easily remedied. For the issue of incorrectly choosing non-performing and substandard supplier, the power tool company must first establish a strict criteria before looking for a supplier. These criteria must reflect the objectives, quality standard and timel iness of the company and must be met by the supplier in consideration. This would avoid incorrectly choosing a wrong supplier. For the issue of binding the company to a wrong supplier, it can be remedied by stipulating an opt out and a fine in the event that supplier will renege the contract. This will compensate the company for any

Critically assess the main implications of globalisation for HRM, and Essay - 1

Critically assess the main implications of globalisation for HRM, and analyse the future challenges for people management within - Essay Example The main implications of globalization for HRM are in terms of people management and in taking care of the day to day affairs of the organization, which essentially mentions where shortcomings and apprehensions arise and how best to do away them in a convenient way (Richter, 2006). This paper highlights how globalization has affected HRM and how several employee levels within an organization work to their best possible levels to bring that vital change which is much needed. Also significance is laid on different premises like cultural manifestations, people to people linkages, role of top management and specialists, and the usage of resources for the overall betterment of the organizations and the productivity basis of the employees in the long run. It is significant to first define how globalization has affected HRM. With the advent of time and age, globalization has influenced each and every segment of life and professional domains are no exception to this rule. Similarly, HRM gets its basis from the professional regimes where emphasis is on getting the job done for the sake of people management, which includes recruiting, firing and so on. ... The main implications of globalization for HRM depend a great deal on how globalization is viewed in essence and how it is able to resolve the ambiguities which stand in the way of HRM dependence. There is a dire need to comprehend the fact that HRM will take care of all such nuances if handled in an amicable fashion. Also the manner in which HRM will manifest its truest role is something that goes to show how things are deemed as important under the aegis of the workplace discussions. Globalization has indeed come out as an eye-opener for many organizations around the world and it is for this reason that there are immensely significant pointers that shall be discussed and delved deep upon in this paper. When HRM is seen from a global perspective, different employees are hired who belong to distinctive cultures from around the world. How they are managed is an interesting phenomenon which needs to be seen from the organizational and industrial standpoints. These employees do find it hard to adjust within various workplace locations yet are always willing to bring a change within their personalities and domains to suit the needs and requirements of the organizations they work for. The earnestness on their part to bring about a change is always present. The need is to comprehend how to set things right within the organizational settings so that HRM presents a true picture. Globally speaking, HRM is always given preference within an organization because it creates an instructional basis for the employees and tells them the difference between the right and the wrong. It is a fact that those organizations which have many employees on board usually look up to their HRM domains in order to bring sanity within recruitment, day to day people management and

Discuss the relationship between given gender roles and atypical Essay

Discuss the relationship between given gender roles and atypical gender roles - Essay Example They are often thought to be similar concepts. The word "sex" can be used when a person wants to refer to only the biological differences that exist between man and woman. Sexual differences between males and females are universal. On the other hand, the word "gender" is used when a person wants to express the social differences between man and woman. 2In our essay, we are focusing on the social differences between man and woman and how they are expected to behave, look, and feel like their own gender rather perform atypical gender roles. Gender is a much more complicated thing to understand and it is a behaviour which is learned and changed with time. It changes from culture to culture. Gender roles is composed of several elements, be it be ones dressing, his behaviour pattern, their choice of career or work life how they go about when it comes to personal relationships, and many other factors. Gender roles can be exhibited by as small a thing as the way a message is composed in an SMS (short message service). In the old ages, gender roles were very specific and there was a sharp line between what men will do, think and feel like and how women are supposed to do these things. But since then and now, a vast difference has come because times are changing and the mind set of the people is expanding to allow acceptance for flexibility of gender roles. Nowadays, the strictly defined gender roles of the past have been re defined to reflect some wider acceptable gender roles of males and females. 3 People have unique ways of expressing their gender roles. Moreover, the gender role terminology is highly dependent on what culture, country, society and era it belongs to. Gender roles might be given or typical depending on the context in which they are being studied.4 Given gender roles are ones which are expected out of men and women to exhibit and on which

Al Qaidas Major Domestic Attack on the United States Research Paper

Al Qaidas Major Domestic Attack on the United States - Research Paper Example This includes the recent attack on U.S. embassy in Yemen and evidence proves the involvement of the Al-Qaida group in the attack (Ghobar and Blair 2012). The Al-Qaida group has been reignited by the launch of film â€Å"The Muhammad† and has openly announced increase in terrorist attacks against the US (Hasni 2012) Many researchers and analyst, studying Al-Qaida’s strategies and threats, forecasted that the death of their former leader Osama Bin Ladin, would be the major setback for the group. Unfortunately, this prediction turns out to be false as the strength of the Al-Qaida group does not look to shrink, with their new leader and new strategies (Geltzer 2010). After the death of Al-Qaida’s former leader and administrator, members of the group started spreading in different European countries with fake nationality, to escape from the US invasion in Afghanistan and Iran (Hollywood, Synder, Mckat, Boon 2004). Al-Qaida’s movement in South Asian countries, have also been reported, giving signs of their flexibility to change, with regard to the situation. So even now, they should be considered as a serious threat as they do not look to settle down or get weaken (Geltzer 2010). Joshua Geltzer, in his book highlights key factors, which have nailed in the Al-Qaida troop. This includes killing of Osama Bin Ladin, the most prominent figure of this group and the mastermind behind most attacks made by the Al-Qaida (Geltzer 2010). In addition, US army has been successful in tracing down locations of Al-Qaida’s members worldwide and eradicating them from the face of the earth. Moreover, their funds of around $140 million and a large number of weapons have been captured (Geltzer 2010). And they have been forced to leave their homeland in Afghanistan, from where they used to meet and plan their terrorist activities. But despite all these factors, Al-Qaida still stands as a big threat to Western or Non-Islamic countries, especially the U.S.A (Khalsa 2004).   

Discuss the relationship between given gender roles and atypical Essay

Discuss the relationship between given gender roles and atypical gender roles - Essay Example They are often thought to be similar concepts. The word "sex" can be used when a person wants to refer to only the biological differences that exist between man and woman. Sexual differences between males and females are universal. On the other hand, the word "gender" is used when a person wants to express the social differences between man and woman. 2In our essay, we are focusing on the social differences between man and woman and how they are expected to behave, look, and feel like their own gender rather perform atypical gender roles. Gender is a much more complicated thing to understand and it is a behaviour which is learned and changed with time. It changes from culture to culture. Gender roles is composed of several elements, be it be ones dressing, his behaviour pattern, their choice of career or work life how they go about when it comes to personal relationships, and many other factors. Gender roles can be exhibited by as small a thing as the way a message is composed in an SMS (short message service). In the old ages, gender roles were very specific and there was a sharp line between what men will do, think and feel like and how women are supposed to do these things. But since then and now, a vast difference has come because times are changing and the mind set of the people is expanding to allow acceptance for flexibility of gender roles. Nowadays, the strictly defined gender roles of the past have been re defined to reflect some wider acceptable gender roles of males and females. 3 People have unique ways of expressing their gender roles. Moreover, the gender role terminology is highly dependent on what culture, country, society and era it belongs to. Gender roles might be given or typical depending on the context in which they are being studied.4 Given gender roles are ones which are expected out of men and women to exhibit and on which

ORGANISATIONAL POLITICS, CULTURE AND MANAGEMENT Essay

ORGANISATIONAL POLITICS, CULTURE AND MANAGEMENT - Essay Example shing selected aims.† For Henry Fayol â€Å"To Manage is to forecast, to plan, to organize, to command, to co-ordinate and to control† (Robbins, Bergman, Stagg & Coulter 2012). These are the major functions performed by any manager in any organization although the functions differ depending on the size of the organization. To perform these functions, managers do need to have power and authority in order to elicit compliance and commitment from the employees. However, with all the resources in the world, an organization cannot achieve its goals if it is not accompanied by effective management especially in modern times when management has become so complex and demanding owing to globalization. Effective management in this case, depends on how well the managers exercise their power and authority over subordinates. In this essay, I will argue that management is both an art and a science which requires effective exercise of power to elicit compliance and commitment. I will argue that it is an art in the sense that it has its own creative skills, tools and techniques. It also requires intelligence, innovation, an individual approach, discipline and dedication as well as practicability. It is a science in that it utilizes empirically tested principles and draws heavily from social sciences such as economics, sociology and psychology. To be successful in the management field, management cannot be reduced to either an art or science but should be taken as both an art and a science. Managers in the organization exercise various types of power in an effort to influence the followers so that they can be committed and engaged to their work hence improved performance and success for the organization. Koontz and Weihrich define power as â€Å"the ability of individuals or groups to induce or influence the beliefs or actions of other persons or groups (2008: 179). Influence in this case according to Silos (2003) is the ability to make the followers strive towards a common

Foundations of teaching and learning Essay Example for Free

Foundations of teaching and learning Essay I am going to deliver a lesson to my students, which will include the three main schools of learning, Behaviourism, Cognitivism and Humanism. I will incorporate these ways of learning into my lesson plans to ensure my students are offered a range of learning strategies. â€Å"The behaviourist learning theory suggests that we learn by receiving a stimulus that provokes a response. So long as the response is reinforced in some way that response will be repeated. † (Reece and Walker 2007) I think behaviourism is important within the classroom as it is controlled Education, where the teacher takes control of the class and the environment that the students are in. Behaviourism is the educational theory that is based on the underlying ideology that the environment has direct influence on behaviour. Aims and objectives must be shown at the beginning of the class, to ensure the students are aware of what is expected of them. Reinforcement should be used to strengthen behaviour that you want to encourage. Students should be rewarded immediately so it gives the student motivation and confidence to move on to the next stage. Rewards can be offered in a variety of ways e. g. praise, letting them take part in something they enjoy doing, and should be used often when starting a new subject. To ensure students are kept motivated. Behaviourists look for rewards from others such as teachers, family and peers etc. †¦ Some behaviour is inappropriate so a punishment is given to stop that particular behaviour occurring again. People learn by copying from others, for example, performing a demonstration (you are the model) students will learn behaviours from the model. Within my lesson plan I have covered behaviourism with discussing previous background knowledge of subject matter so I am able to gain the required information to move on to the next stage and by applying praise to give them confidence to be able to move on to the next stage. I will take control of the class; the environment within the class will be relaxed and non-threatening. I will offer encouragement and appraisal throughout my lesson, before the end of the lesson I have arranged practical session as a reward. The Cognitivist school believes that learning by doing, and asking students challenging questions, will help students make their own sense of what they era studying, and enable them to make use of their learning in real life† (Geoff Petty2009) The Cognitivist approach to learning focuses on students and how they gain and store knowledge. It looks into how students interpret information given to them and what technique is best for them to use to understand it. The information that is given to the students must be understood to ensure leaning is taking place. It should be presented in a step by step fashion and goals should be in place for each stage, Feedback is essential and should be given out promptly to ensure learning has taken place before moving on to the next stage. There are three modes of learning †¢ The Enactive mode – learning by doing †¢ The Iconic mode – imagery- depends on visual senses †¢ The symbolic mode – using codes to learn This approach should be used in an attempt to promote learning using the cognitive structure. Students learn more when they have a greater understanding of the knowledge within the subject matter. This information is taken and added onto existing information, which is known as deep learning. Deep learning is where new learning makes a connection to old learning so you are able to build on knowledge, Deep learning is good learning; students should be taught a way that encourage them to adopt a way of learning, so they have a deeper understanding. There is also surface learning where there is no connection at all from old learning to new. There is only a small amount of cognitive skills used, and the new subject material has no relevance to previous learning. Studies more recently have shown deeper approaches to learning are related to higher quality learning outcomes† (Ramsden 1992; Prosser and Miller 1989; Trigwell and Prosser, 1991). Learning takes place through individuals changing and processing information from their social and physical surroundings. The teaching strategies for this theory should include things such has class presentations, debates and lectures, videos, readings and case studies. Work material should always be clear to understand, and produced in an organised manner, precise objective feedback should be given to facilitate learning. The amount of knowledge and understanding already attained will influence the speed and capability to add subsequent learning. I have used the cognitivism school of learning within my lesson plan by using deep surface learning, I am going to be building students’ knowledge through learning new subject matter to add on to old. I will take into account the structure of the subject matter delivering it in a step by step manner that is meaningful and understandable to them so they can relate new information to what they already know. My teaching methods will emphasis common principles and transferable skills. I have set tasks so they will have to think for themselves and discover new ways of finding out things about themselves and finding answers within the tasks. There will also be class discussions throughout the lesson, so students have the opportunitiy to express themselves, the classroom environment will be pleasant and relaxed so the students do not feel afraid to speak out. I will be performing a demonstration for students so they will be able to understand exactly what I want them to learn† by doing â€Å". â€Å"The only way to learn how to do something is by doing it! † (Paul Ginnis 2002) Humanism is about the learner feeling good about him or herself and being able to determine their strengths and weaknesses. The learner should believe that able to have the ability to improve. It is important that students feel good about themselves so they are able to set goals that are achievable; this should be encouraged by the teacher to help develop student’s self-esteem. ] All topics should be relevant to the student so it keeps them interested and motivated. Students should not feel that they have done wrong, but use mistakes as an opportunity to learn. Hierarchy of Basic Human Needs [pic] Abraham Maslow 1962) It is essential that the lower needs are met before moving up to the next level in a step by step way. In a classroom setting, these needs must be fulfilled to ensure effective learning can take place. Starting with physical needs working up to self- actualisation. The teacher should make the classroom environment feel warm and friendly with a positive atmosphere, and give students the choice to work at their own pace and let them take responsibility to learn for themselves, so that they become highly motivated by working in an area of their own interests and curiosity. Humanistic teaching enables students to figure things out for themselves because over helping from the teacher will discourage and de motivate the student. Students are encouraged more by active learning than passive learning. It gives the student great motivation when they are able to solve their own problems. The prize for the humanistic theorist is through self-evaluation and self-direction humanists like to reward themselves. Self-assessment is a crucial skill it helps students to be responsible for their own improvements where tests set by teachers are thought of as discouraging – and lowering student’s self-esteem. I have incorporated humanistic teaching within my lesson plan through classroom environment; the layout of my class room is designed to suit the student’s needs. There will be adequate breaks, I will ensure comfortable surroundings, all students will be treated fairly and with dignity and confidentiality will be maintained at all times. I intend to promote interaction between students and show that I care. I will encourage independence and welcome ideas and offer prizes when appropriate, promote optimism and be enthusiastic and supportive and be positive about their future plans. So with this support I have applied basic needs within the classroom so my students will reach self-actualization I have set tasks where students will have to think for themselves and come up with their own conclusions. I have also included a practical activity where students will work in pairs and have to think between them to evaluate the outcome. We will be in an environment where the students are comfortable and the learning subject matter is relevant to the learner’s objectives. I think that the three main schools of learning should be incorporated within a lesson because I strongly agree with Maslow’s hierarchy of basic needs. You need to meet physical needs to be able to move up the ladder without these needs you are unable to achieve or reach self actualisation. I believe that the humanistic approach to teaching and learning is used through all ages of teaching but is more influenced with adult education. Whereas behaviorism I believe is for the younger generation. Behaviorism teaching starts from an infant they are influenced by reinforcements and that is how good behavior is determined from bad. I think this is more effective with school age children. It helps to promote learning when a child is praised. The cognitivist theory plays a big part in learning, learning should be a part of life humans have a natural urge to learn, discover and develop new skills. I agree that it is important that the learning that is taking place and the information is recognized. Marking and feedback is essential and plays a big part in student achievement, so you can evaluate where the students understood.

Genetic Diversity and QoI Fungicide Resistance

Genetic Diversity and QoI Fungicide Resistance Study of genetic diversity and QoI fungicide resistance in frogeye leaf spot (Cercospora sojina) from Tennessee Introduction Frogeye leaf spot (FLS) of soybean (Glycine max Merr.), caused by the fungal pathogen C. sojina Hara, was first identified in Japan in 1915 and South Carolina, the United States in 1924 (Lehman 1928; Phillips 1999). FLS is an important foliar disease of soybean although symptoms can appear on stems, pods, and seeds. There has been no report of the alternative host in other crops or weeds (Mian et al. 2008). Initial symptom appears as small, light brown circular spot which is later surrounded by darkish brown to reddish circle. (Dashiell and Akem 1991). As the leaves are covered with 50% lesions, leaves start to blight wither and finally falls prematurely. On the lower surface of leaves, the central spot of lesions is somewhat grayish because of conidia produced on conidiophores. Conidia are a primary and secondary source of inoculum and are produced in infected leaves, stems, and pods. Warm temperature and frequent rainfall are suitable factors for severe disease, and fully expanded leaves are more resistant with small lesions as compared to younger leaves (Phillips 1999). The United States is the leading producer of soybean in the world. According to the food and agriculture organization (FAO), the US produced 108 million metric tons of soybeans, second only to corn in 2014 (http://faostat3.fao.org/). FLS is an important disease in most of the soybean growing countries in the world and the main factors hindering the yield includes a reduction in photosynthetic area and premature defoliation of leaves (Mian et al. 2008; Wrather et al. 2010). In the US, FLS is significantly present in Southern warm and humid regions (Mian et al. 2008; Yang et al. 2001). Now, C. sojina is also important to Northern states as the disease was reported in Iowa in 1999, Wisconsin in 2000 (Mengistu et al. 2002) and Ohio in 2006 (Cruz and Dorrance 2009). The damage caused by FLS depends on soybean cultivars and locations, and yield loss has been reported from 10% to more than 60% (Dashiell and Akem 1991; Hartwig and Edwards Jr 1990; Laviolette et al. 1970; Mian et al. 1998). FLS is a polycyclic disease and the disease remains active throughout the growing season (Kim et al. 2013; Laviolette et al. 1970). Dispersal of conidia to some distance is favored by the wind and water splashes (Laviolette et al. 1970). Mycelium of C. sojina can overwinter and a report suggests potential survival of the pathogen in the plant debris for two years (Zhang and Bradley 2014). There are several FLS control methods including cultural practices, use of fungicides and genetic resistance. Primarily, genetic resistance is a most effective measure to control FLS. Till now, three resistant genes Rcs (Resistant to C. sojina), have been deployed: Rcs1 (Athow and Probst 1952), Rcs2 (Athow et al. 1962) and Rcs3 (Phillips and Boerma 1982). The Rcs3 gene confers resistant against race 5 and all known races of C. sojina present in the USA. (Mengistu et al. 2012; Phillips and Boerma 1982). Similarly, crop rotation for two years has been suggested to skip viable inoculum and prevent dise ase severity in the field (Grau et al. 2004; Zhang and Bradley 2014). Further, use of pathogen-free seeds and necessary application of fungicides before flowering to early pod stage have been practiced to decrease disease severity (Grau et al. 2004). Meanwhile, because of change in the pathogen, it has been proven that resistant gene can confer resistance for a certain period and there can be selection against QoI fungicides too (Athow and Probst 1952; Athow et al. 1962; Zeng et al. 2015). There has already been a report of field isolates resistant to QoI fungicides in Tennessee (Zhang et al. 2012). Control measures like use of fungicides and planting of resistant cultivars force pathogens to select against selection pressure. Studies of C. sojina using several approaches indicate diversity among isolates. Because of the lack of universally accepted soybean differentials, its hard to characterize and compare C. sojina isolates. Grau et. al. (2004) have reported 12 races of C. sojina in the US, 22 races in Brazil and 14 races in China. A new set of 12 soybean differentials and 11 races have been proposed based on the reaction of isolates collected from the USA, Brazil, and China (Mian et al. 2008). However, the reaction of 50 isolates from Ohio on the same 12 soybean differentials produced 20 different races (Cruz and Dorrance 2009). There has been a handful of research to characterize C. sojina based on molecular markers. One study includes AFLP based assessment of 62 isolates from Brazil, China, Nigeria and the United States, which showed a significant amount of genetic diversity among isolates, although genotypes did not cluster based on origin. (Bradley et al. 2012). Recently, a study of 132 isolates fr om Arkansas with simple sequence repeat (SSR) has shown the chances of sexual reproduction and high genetic diversity in C. sojina (Kim et al. 2013). The main objectives of this study were to access: genetic diversity by developing and using novel SNP markers and distribution of QoI resistant and sensitive isolates from Jackson and Milan, TN. Sample collection, Single-lesion Isolation, and DNA extraction In 2015, soybean leaves exhibiting typical symptoms of infection with FLS were collected from research plots at two locations in Tennessee (Milan and Jackson). In total, 437 isolates, 203 from Jackson and 234 from Milan, were collected from eight fungicides treated and non-treated Maturity group III soybean cultivars (Table 1). Cultivars were planted in 4 rows (30-inch row spacing), 30 ft long plots in a randomized complete block design with four replications. Plots were split, two rows were not treated, and two rows were treated at R3 growth stage (beginning pod) with Quadris Top SB at 8 fl oz/a (Azoxystrobin and Difenoconazole, Syngenta Corp., Basel, Switzerland). A single isolate of C. sojina was obtained from a single lesion from each leaf. Sporulation was induced by incubating leaves in a plastic bag with moist towels at room temperature. Spores were harvested with a flame-sterilized needle using a dissecting microscope and 8-10 spores transferred to RA-V8 agar media (rifampicin 25 ppm, ampicillin 100 ppm, 160 mL unfiltered V8 juice, 3 gm calcium carbonate and 840 mL water). Observations were made daily and contaminated sectors removed. After seven days, single-lesion isolates of C. sojina were transferred to a new V8 agar media. In addition, a set of 40 isolates from 10 different states, collected before 2015, were included in this study (Table 2). Table 1. Soybean cultivars and number of Cercospora sojina isolates recovered from treated and non-treated cultivars. Cultivar ID Cultivars Jackson Milan Total Treated Non-treated Treated Non-treated C1 VAR Armor 37-R33 RR2 17 11 21 4 53 C2 VAR Asgrow AG3832 GENRR2Y 7 15 20 14 56 C3 VAR Becks 393R4 0 0 0 3 3 C4 VAR Croplan R2C 3984 19 13 11 14 57 C5 VAR Mycogen 5N393R2 RR2 g 12 20 17 28 77 C6 VAR Terral REV 39A35 10 15 13 16 54 C7 VAR USG 73P93R 22 6 13 21 62 C8 VAR Warren Seed 3780 R2Y It 14 22 13 26 75 Table 2. Number of Cercospora sojina isolates collected from Jackson (JTN) and Milan (MTN), Tennessee in 2015 and historical isolates from various states in previous years. Location No. of Samples Year JTN 203 2015 MTN 234 2015 AL 5 2006 AR 5 2006 FL 1 2006 GA 4 2006 IA 1 2006 IL 2 2006/09 LA 1 2006 MS 6 2006 SC 2 2006/2009 TN 12 2007 WI 1 2006 Note: JTN (Jackson) and MTN (Milan) collection in 2015 in Tennessee. TN is a historical collection. For DNA extraction, the single-lesion isolates were grown in 24-well deep well plates (Fisher Scientific) with 1 mL RA-V8 liquid broth (same as above, minus the agar) per well. DNA was extracted as described by Lamour and Finley (2006). Briefly, this includes harvesting mycelium from the broth cultures into a 96-well 2 mL deep well plate pre-loaded with 3-5 sterilized 3 mm glass beads. The plates are freeze dried and the dried mycelium powdered using a Mixer-Mill bead beating device (Qiagen). The powdered mycelium was then lysed and a standard glass fiber spin-column DNA extraction completed. The resulting genomic DNA was visualized on a 1% gel and quantified using a Qubit device. SNP marker discovery and targeted-sequencing based genotyping Whole genome sequencing was accomplished for three FLS isolates from a historical collection originally compiled by Dr. Dan Philips, UGA: FLS11 (CS10117) recovered from Milan, Tennessee in 2010, FLS19 (TN10) from the Georgia Experiment Station, and FLS21 (TN85) which was recovered from Mississippi. Genomic DNA was extracted from freeze-dried and powdered mycelium using a standard phenol-chloroform approach and the resulting DNA was submitted to the Beijing Genomics Institute in China for 2100 paired-end sequencing on an Illumina HiSeq2000 device. De novo assembly, read mapping and SNP discovery was accomplished with CLC Genomics Workbench 7 (Qiagen). As there was no public reference genome available at the time, FLS21 was de novo assembled using the default settings in CLC and the resulting contigs used as a reference genome. All open reading frames (ORFs) longer than 300 amino acids were predicted using CLC and annotated onto the FLS21 contigs. The raw reads from FLS11 and FLS19 wer e then mapped to the draft reference (separately), and putative single nucleotide variants (SNVs) identified at sites with at least 20X coverage and an alternate allele frequency greater than 90%. A subset of the SNVs was chosen from the largest contigs for further genotyping using a targeted sequencing approach. Custom Perl scripts were used to extract the flanking sequences for the panel of SNPs and primers were designed using BatchPrimer3 v1.0 (http://probes.pw.usda.gov/batchprimer3/) to amplify targets between 80 and 120bp in length. Primers for 50 SNPs including mitochondrial QoI resistant locus are summarized in Table 3. Primer sequences and genomic DNA were sent to Floodlight Genomics (Knoxville, TN) for processing as part of a non-profit Educational and Research Outreach Program (EROP) that provides targeted-sequencing services at cost for academic researchers. Floodlight Genomics uses an optimized Hi-Plex approach to amplify targets in multiplex PCR reactions and then sequences the resulting sample-specific amplicons on either an Illumina or Ion NGS device. Resulting sample-specific sequences were mapped to the reference contigs and genotypes assigned for loci with at least 6X coverage. QoI resistant locus genotyping A single nucleotide polymorphism (G/C) in the Cytochrome b gene of the C. sojina mitochondrial genome has been shown to confer resistance to QoI fungicides. A custom TaqMan SNP genotyping assay will be designed using the online design tools from Applied Biosystems (Thermo Scientific) and include the forward primer GGGTTATGTTTTACCTTACGGACAAATG and reverse primer GTCCTACTCATGGTATTGCACTCA and two probes to discriminate resistant and sensitive isolates: ACTGTGGCAGCTCATAA with VIC for the C resistance allele and ACTGTGGCACCTCATAA with FAM for the G sensitive allele (Zeng et al. 2015). Quantitative PCR (qPCR) will be accomplished based on manufacturer instruction using the QuantStudio 6 Flex Real-time PCR System (Thermo Fisher Scientific Inc.). Mating types determination A previously described multiplex PCR assay will be used to assign mating type (MAT1-1-1 or MAT1-2) to a subset of the isolates that had unique multi-locus SNP genotypes (Kim et al. 2013). The MAT1-1-1 locus will be amplified with CsMat1f (5 TGAGGACATGGCCACCCAAATA) and CsMat1r (5 AAGAGCCCTGTCAAGTGTCAGT) and the Mat1-2 locus will be amplified with CsMat2f (5 TGTTGTAGAGCTCGTTGTTCGCA) and CsMat2r (5 TCAGACCTTATGAGCTTGAAAGTGCT) primers (Kim et al. 2013). The assay will be included with the ITS5 (5 GGAAGTAAAAGTCGTAACAAGG) and ITS4 (5 TCCTCCGCTTATTGATATGC ) primers as an internal control to amplify the internal transcribed spacer (ITS) region (White et al. 1990). The resulting PCR products will be visualized under UV light on 2% agarose gel stained with GelRed (Phenix Research Products) and scored based on fragment size of MAT1-1-1 (405 bp) and Mat1-2 (358 bp). Data Analysis SNP loci for each sample will be combined to form a multi-locus SNP genotypes and samples with identical genotype (clonal lineages) will be clone corrected. To assess population structure among the two locations (and in relation to the historical isolates), Bayesian clustering will be accomplished using Structure 2.3.4 (Pritchard et al. 2000). Structure Harvester (Earl 2012) will be used to find the most probable value of K from the results obtained from Structure analysis. Principle coordinate analysis, AMOVA, Nei pairwise genetic distance, Nei pairwise genetic identity and genetic indices will be analyzed with GENALEX (Peakall and Smouse 2006). Phylogenetic clustering of the unique genotypes will be accomplished using Mega 6.06 (Tamura et al. 2013). Minimum spanning networks (Bandelt et al. 1999) will be constructed with PopART (http://popart.otago.ac.nz/). Expected Results Novel SNP markers will be developed and assayed in C. sojina isolates. Population study will help to determine if the isolates from two locations are sub-grouped. The genetic study will also accesses genetic diversity present within and among populations. Molecular identification of mutated cytochrome b site will help to determine the distribution of resistant isolates and contribute to compare resistant isolates in fields between two different time periods. Study of two different mating types in population will help to predict sexual reproduction. References Athow K and Probst AH. 1952. The inheritance of resistance to frog-eye leaf spot of Soybeans. Phytopathology 42(12):660-662 pp. Athow KL, Probst AH, Kurtzman CP and Laviolette FA. 1962. A newly identified physiological race of Cercospora sojina on soybean. Phytopathology 52(7):712-714 pp. Bandelt H-J, Forster P and RÃ ¶hl A. 1999. Median-joining networks for inferring intraspecific phylogenies. Molecular biology and evolution 16(1):37-48. Bradley C, Wood A, Zhang G, Murray J, Phillips D and Ming R. 2012. Genetic diversity of Cercospora sojina revealed by amplified fragment length polymorphism markers. Canadian Journal of Plant Pathology 34(3):410-416. Cruz C and Dorrance A. 2009. Characterization and survival of Cercospora sojina in Ohio. Plant Health Progress doi 10. Dashiell K and Akem C. 1991. Yield losses in soybeans from frogeye leaf spot caused by Cercospora sojina. Crop Protection 10(6):465-468. Earl DA. 2012. STRUCTURE HARVESTER: a website and program for visualizing STRUCTURE output and implementing the Evanno method. Conservation genetics resources 4(2):359-361. Grau CR, Dorrance AE, Bond J and Russin JS. 2004. Fungal diseases. Soybeans: Improvement, production, and uses(soybeansimprove):679-763. Hartwig E and Edwards Jr C. 1990. The uniform soybean tests, southern region, 1989. USDA Mimeographed Rep. US Gov. Print. Office, Washington, DC. Kim H, Newell AD, Cota-Sieckmeyer RG, Rupe JC, Fakhoury AM and Bluhm BH. 2013. Mating-type distribution and genetic diversity of Cercospora sojina populations on soybean from Arkansas: Evidence for potential sexual reproduction. Phytopathology 103(10):1045-1051. Laviolette F, Athow K, Probst A, Wilcox J and Abney T. 1970. Effect of bacterial pustule and frogeye leafspot on yield of Clark soybean. Crop science 10(4):418-419. Lehman S. 1928. Frog-eye leaf spot of Soy Bean caused by Cerco-spora diazu Miara. Journal of Agricultural Research 36(9):811-833. Mengistu A, Bond J, Mian R, Nelson R, Shannon G and Wrather A. 2012. Resistance to Frogeye Leaf Spot in selected soybean accessions in MG I through MG VI. Plant Health Progress 10. Mengistu A, Kurtzweil NC and Grau CR. 2002. First report of Frogeye Leaf Spot (Cercospora sojina) in Wisconsin. Plant Disease 86(11):1272-1272. Mian M, Boerma H, Phillips D, Kenty M, Shannon G, Shipe E, Blount AS and Weaver D. 1998. Performance of frogeye leaf spot-resistant and-susceptible near-isolines of soybean. Plant disease 82(9):1017-1021. Mian M, Missaoui A, Walker D, Phillips D and Boerma H. 2008. Frogeye Leaf Spot of Soybean: A review and proposed race designations for isolates of Hara. Crop science 48(1):14-24. Peakall R and Smouse PE. 2006. GENALEX 6: genetic analysis in Excel. Population genetic software for teaching and research. Molecular ecology notes 6(1):288-295. Phillips D. 1999. Frogeye leaf spot. Compendium of soybean diseases, 4th ed. American Phytopathological Society Press, St. Paul, MN:20-21. Phillips D and Boerma H. 1982. Two genes for resistance to race 5 of Cercospora sojina in soybeans. Phytopathology 72(7):764-766. Pritchard JK, Stephens M and Donnelly P. 2000. Inference of population structure using multilocus genotype data. Genetics 155(2):945-959. Tamura K, Stecher G, Peterson D, Filipski A and Kumar S. 2013. MEGA6: molecular evolutionary genetics analysis version 6.0. Molecular biology and evolution:mst197. White TJ, Bruns T, Lee S and Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR protocols: a guide to methods and applications 18(1):315-322. Wrather A, Shannon G, Balardin R, Carregal L, Escobar R, Gupta G, Ma Z, Morel W, Ploper D and Tenuta A. 2010. Effect of diseases on soybean yield in the top eight producing countries in 2006. Plant Health Progress doi 10:2008-2013. Yang X, Uphoff M and Sanogo S. 2001. Outbreaks of soybean frogeye leaf spot in Iowa. Plant Disease 85(4):443-443. Zeng F, Arnao E, Zhang G, Olaya G, Wullschleger J, Sierotzki H, Ming R, Bluhm B, Bond J and Fakhoury A. 2015. Characterization of quinone outside inhibitor fungicide resistance in Cercospora sojina and development of diagnostic tools for its identification. Plant Disease 99(4):544-550. Zhang G and Bradley CA. 2014. Survival of Cercospora sojina on soybean leaf debris in Illinois. Plant Health Prog 10. Zhang G, Newman M and Bradley C. 2012. First report of the soybean frogeye leaf spot fungus (Cercospora sojina) resistant to quinone outside inhibitor fungicides in North America. Plant Disease 96(5):767-767.

Does TV Affect American Culture Essay -- essays research papers

Does Television Shows Reflect American Culture? There are many movies and television shows that reflect American culture. A show or movie must address some current societal problem or trend in order to truly reflect American life; murder, rape, racism, and, on a less serious note, parties, shopping, and sports are topics that deserve serious consideration by the public and the media. The show Beverly Hills 90210 attempts to be an accurate portrayal of the life of a typical well-off American teenager growing up in the 80's and 90's. The producers of the show attempt to integrate many real life situations in to the show. By doing this they are suggesting to the audience, which happens to be geared toward teenagers and young adults, that what the characters do in the show is the ideal way to deal with these types of situations. Many aspects of American culture are represented on the television show Beverly Hills 90210, or just 90210 as it is commonly referred to. During the first year or so of Beverly Hills 90210 it dealt with the su bject of murder/homicide. One of David's best friends was playing with a gun that he had acquired during a summer vacation to the mid-West. The friend shot himself by accident; what followed was a time of mourning for David and a recollection of many fond memories of the times they shared together. This episode's tragedy brought the characters in the show closer together. Many innocent children, and sometimes adults, are killed accidentally playing with guns, or by drive-by shootings. This is a major problem in the United States and the show is trying to get the message out that it is not a safe thing to do. It also raises the question as to why access of guns is so readily available to anyone. Every night on the news, someone can see many incidents in which there are suffering resulting from guns. Furthermore, the availability of guns makes the public scared. Children have images of adults using guns for hunting or game. In the adolescents' mind it appears that guns are not a bad i tem to own, when in reality guns are extremely dangerous weapons. Beverly Hills 90210 makes a strong attempt to impress upon its viewers that these accidents can be precautions. The show sends a message to the younger generation, which are becoming more and more violent, to stay away from things that result in violence like... ...s right in with the materialistic values promoted by our society in print, in television, in commercials, in movies - in other words, in all aspects of the media. All economic echelons of society in the United States are encouraged to purchase name brand clothing and other apparel. The"American Dream" of shopping and credit cards is a reality in the show. The setting of the show is Beverly Hills, California, the home of all the popular trends and famous stars. This location, along with rich parents, provides for the perfect situation to make them look like rich brats. Although Beverly Hills 90210 is not a perfect reflection of American culture, it does lend itself to the stereotype of having a huge wardrobe and living the "American Dream". In the ten years during which 90210 has been on the air, the show has dealt with many topics. From the Persian Gulf War and high school, to AIDS and the Internet, the show has reflected many aspects of American culture. Beve rly Hills 90210 sends a message to the viewers to make the best of one's life. Hopefully many of the viewers will be able to attain the "American Dream" that is the essence of American culture.

Law of Diminishing Returns :: essays papers

Law of Diminishing Returns The Law of diminishing returns is a key one in economics. It is used to explain many of the ways the economy works and changes. It is a relatively simple idea; spending and investing more and more in a product where one of the factors of production remains the same means the enterprise will eventually run out of steam. The returns will begin to diminish in the long run. If more fertilizer and better machinery are used on an acre of farmland, the yield will increase for a while but then begin to slow and become flat. A farmer can only get so much out of the land, and the more the farmer works, the harder it gets. The economic reason for diminishing returns of capital is as follows: When the capital stock is low, there are many workers for each machine, and the benefits of increasing capital further are great; but when the capital stock is high, workers already have plenty of capital to work with, and little benefit is to be gained from expanding capital further. For example, in a s ecretarial pool in which there are many more secretaries than computer terminals, each terminal is constantly being utilized and secretaries must waste time waiting for a free terminal. In this situation, the benefit in terms of increased output of adding extra terminals is high. However, if there are already as many terminals as secretaries, so that terminals are often idle and there is no waiting for a terminal to become available, little additional output can be obtained by adding yet another terminal. Another application for this law is in Athletics, for runners, their investment is the time and energy put into training and the yield is hopefully improved fitness. Early in their running careers or early in the training program a couple of weeks of regular training would be rewarded with a considerable increase in fitness. Having achieved a very fit state though, two weeks of regular training will achieve a barely perceptible increase in fitness.

M.A. English

Each course British Poetry British Drama British Novel Aspects of Language will comprise one assignment of 100 marks. This assignment be tutor marked. Aims: The TMAs are conceffred rrainly with assessing your application and understanding of the course material. You are not required to reproduce chunks of information from the course material but to use the skills of critical appreciation that you may have acquired during the course of study. These assignments airn to teach as well as to assess your performance.Please ensure that you read the texts and the ccompanying study guides that we have prepared for you. Let rne repeat: you must read all the texts prescribed. Do make points as you go along. It there is anything you do not understand, please ask your Counsellor at the Study Centre for clarification. Once you are able to do the assignments satisfactorily, you will be ready to take the exam Nith confidence. Instructions: Before attclnpting the assignment please read the following instructions carefully. 2 3 Read the detailed instructicns about the assignments given in the Programme Guide Elective Courses.Write your roll 1 ro. aflle, full address and date on the top right corner of the first page of your response sheet(s). Write the Course Title, Assignment Number and the Narne of the Study Centre you are attached to in the centre ofthe first page ofyour response sheet(s). The top of the first page of your response sheet should look like this: Use only foolscap size paper for your response and tag all the pages caref-ully. Write the relevant question nuinber with each answer.You should write in your own handwriting Submission: T'he completed assignment should be sent to the Coordinator of the Study Centre allotted to you ty 3tr† March, 2aL4 gar Juty 2013 Session) and 30'h Sept 201 i (for January 2014 Session). Please react the instructions given in the Programme Now read the following guidelines carefully before answering the questions. GUIDELINES FOR T MA You will find it useful to keep the following points in mind: 1. Planning: Read the assignment carefully. Make some points regarding each question and then rearrange these in a logical order.And please write the answers n your own words† Do not not reproduce passages from the units. 2. 0rganisation: Be a little more selective and analytic before drawing up a rough outline of your answer. In an essay-type question, give adequate attention to your introduction and conclusion. The introduction must offer your brief interpretation of the question and how you propose to develop it. The conclusion must summarize your response to the question. In the course of your answer, you may like to make references to other texts or critics as this will add some depth to your analysis.Make sure that your answer: ) is logical and coherent; b) has clear connections between sentences and paragraphs; c) is written correctly giving adequate consideration to your expression, style and presentation ; d) does not exceed the number of words indicated in your question. 3. Presentation: Once you are satisfied with your answers. you can write down the final version for submission, writing each answer neatly arid underlining the points you wish to emphasize. You may be aware that you need to submit your assignment hefore you can appear for the Term End Exams.Please remember to keep a copy of your completed ssignment, Just in case the one you submitted is lost in transit. Good luck with your work! Note: Remember the submission of ussignment is precondition of permission of appearing in examination. If you have not submitted the assignment in time you will not be allowed to appear in examination. MEG-OI: BRITISH POETRY Programme: MEG Max. Marks: 1 Ast code: MEG-OI ,TMA12013-1 4 In a conventional class your teacher would have discussed your assignment with you, pointed out what made a good essay and what a bad one. We have done exactly the same thing in Unit 52 of the British Poetry (M EG-OI) course.Read it carefully and discuss it with your counselor and class-fellows at the Study Centre. Thereafter decide upon a topic, i. e. a period or literary group in the history of British poetry. you may, if you wish, select a topic from the list given in sz. z. t (p. 70) in Block X. Alternatively, you could write on a British poet of your choice. you may write on a poet discussed in the units, i. e. on the syllabus, or even a poet we have not discussed in detail such as Robert Burns, G. M. Hopkins, R. S. Thomas, Ted Hughes or Seamus Heaney. You may have heard some of our lectures on The Movement, Philip Larkin nd Ted Hughes on the EduSat.It may now be available on e-gyankosh on wmw. ignou. ac. in You have yet another choice. Write an essay on a famous poem in English literature. Having decide upon your topic, do your research and then read section 36. 5 in Unit 36 in Block VIII for a model essay and a format for presentation. you may learn how to present your term paper/se ssional essay from 36. 5. You must not quote from unacknowledged sou rces. To sum up, write an essay on a period or a literarv group in British poetry or a British poet or a British poem in about 3000 words on the model provided in 36. (in unit 36).The full marks for the essay is 100. We look forward to reading your sessional essay. Sincerely yours Teacher MEG-02: BRITISH DRAMA (Based on Blocks 1-9) Programme Code: MEG Assignment code: N{EG-02 120 1 3-201 4 Maximum Marks: Answer the fbllowing questions in 300 words each. Discuss 2. the plot ot Dr. Faustus. l{ow would you rate A Mid,cummer Night's Dream 3. Clomment on the indecisive bent of mind of Hamlet. (10) 4. What features make Alchemisl an allegory? 5. How is Playboy relevant as a comedy? today? 6. Comment on Pygmalion as a Shavian play. 7. What fbatures make Murder in the Catherlral a poetic drama? 8.Conrnrent on the title of 9. Waiting. tttr Discuss the theme of Look Back in Anger. 10. Irrorn among the plays you have read cho ose any one that you have liked giving reasons lor your choice.Trace the development of modern English fiction with specific referenc6 to the major shifts in literary perspective during the nineteenth century. 20 2. Would it be correct to say that in Tom Jones, Fielding considers mariage to be a ere socio- economic arrangement under which women feel continuously suppressed?Discuss. 3. Discuss the metaphor of the web in the context of events and people relating to Bulstrode in Middlemarch. 4 Suggest the political and artistic implications ot placing the Orientalist paradigm. 5. How does Realism ftnd expression in ofl Passage to British fiction of the 1960s? Base your answer on your understanding of The Prime of Miss Jean Brodie. MEG. 04: ASPECTS OF LANGUAGE course code: All questions are compulsory Write short notes on any two of the following. Competence and performanceLangue and parole Conversion as a morphological device Falling tone and rising tone the conclusion India within sta ge. brietly the history ot language planning snowing clearly the tocus at each Give your own definiti* of language. What are the characteristics of human communication and how is it different from animal communication? 20 What is foregrounding? Discuss this in terms of deviant examples from your reading of literature. ‘Pick out your own examples; say how they are deviant, and what is the impact on the reader. What is the difference between pure vowels and diphthongs? How do you describe both?

The Caused and Effects of Lehman Brothers Bankruptcy

The caused and effects of Lehman Brothers bankruptcy. ? Lehman Brothers was founded in 1850 and it is a diversified investment bank provided financial services for global companies, institutions, governments and investors. Lehman Brothers was one of the most powerful stock and bond underwriters and dealers in the world, and it also as the fourth largest investment bank in the United States before. Because of widely recognized to Lehman’s operational capacity, the company had many world-renowned companies as its customer base such as Dell, Fujitsu, IBM, Intel, Philip Morris, Shell and Wal-Mart [1].Lehman Brothers had faced four collapses before it bankruptcy, one was the stock market crash of 1929, second it had interest rate loss of $6. 7 million in 1973, and then because of Lehman’s internal conflict led to be merger and acquisitions by American Express in 1984, and last one was shortage of funds in 1994. Richard Fuld as Lehman’s CEO from 1993, he led to Lehman Brothers grow up and avoid those four collapses. Even Lehman Brothers was turned the corner in these four collapses; it still declared bankruptcy as a result of $613 billion total debt in 2008 [7].Lehman Brothers went to collapse make lots of impacts on financial markets, the most important reason caused Lehman bankruptcy is under the subprime mortgage crisis and complex financial markets. Before the subprime mortgage crisis of 2007, the U. S. real estate market over the leveraged financing and oil price was increase rapidly, many people in the excessive lending. However, Lehman Brothers had continued business of mortgage bond until the outbreak of subprime mortgage crisis in 2006, Lehman’s asset management, economic services, mergers and securities underwriting business accounted for Lehman's operating income of 40% [2].In 2008, because the subprime mortgage crisis spread to Lehman Brothers, the company suffered a serious hit from the financial losses and caused that stock p rice fell to only a few dollars. In September 2008, the Lehman Brother’s CEO Dick Fuld had experienced the most painful financial crisis in the history of the United States and the company went bankrupt. The Lehman Brothers which had experienced 158 years history toward to end [1]. Also, the collapse of Lehman Brothers brought an unprecedented shock wave for financial market and investment banking. The terrorist attack on 2001, September 11 led to conomic downturn and the stock market depressed, the Federal Reserve decided to continue kept low interest rate to ensure the most of enterprises and publics can achieve loans easier [9]. Due to the public would had more money to be used for mortgages and other spending, Lehman Brother seized the opportunity to develop its business so that Lehman’s profits growth quickly in the second half of 2002. Lehman Brothers’ sales revenue of subprime mortgage raised double of profits in both years 2004 and 2005 [3]. And Lehmanâ €™s present value of subprime mortgage CDO (collateralized debt obligations) investment reached up to $80 billion [5].Lehman Brothers issued two mortgage bonds companies in the United States are BNC and Aurora. These two branches of mortgage bonds and purchased from other companies constituted the CDO package. The worth of CDO could be about hundreds of millions and even billions of dollars to divide for sale to investors around the world. The interest rate of CDO is much higher than the national bonds in the United States and other investments, so Lehman Brother took advantage of sale these bonds to gained large profits. After that, the public began to worried more about future develop of CDOs from Lehman Brothers and other companies.Then, Lehman Brothers shut down one of the mortgage bonds company BNC because of huge losses and this caused the public’s panic of the credit crunch. The public began to suffer a serious mortgage crisis [7]. As a result, the capital losses a nd lack of credit to the banking system, so that no banks willing to lend money unless borrower to pay high interest rate. The banks which involved in this business are worried about losing their money. However, Lehman Brother was still announced good quarterly results even had problems and other investment banks (e. g.JP Morgan Chase, Citibank) had losses. In January of 2008, Lehman Brother reported their earnings shown that highest income up to $4 billion and their capital just $30 billion [2]. At that time their stock price up to $65, but eight months later the price fell to $4 with more than $600 billion debt. Since 2008, Lehman’s stock price had fallen by 60%. Besides, Lehman Brothers had alternative assets about $40 billion such as hedge funds, private equity funds and real estate funds. In May, Lehman Brothers reported that losses in hedge funds but then said they are recovered [11].Because of Lehman’s total debt $613 billion, and then the negotiation with Barcl ays Bank and Bank of America about take over Lehman Brothers was failed on September 14. While at the same time the investment banks gave up to help Lehman Brothers, Lehman’s market value dropped dramatically, these fact forced Lehman Brothers to filed for bankruptcy protection from the U. S. Bankruptcy Court in Manhattan on September 15, 2008 [4]. After filed for bankruptcy, Lehman Brothers exchanged trading at the OTC (Over the Counter) market only $0. 05 per share.Lehman exercised put option to ensure holders could get profit when they buy the stocks as $0. 05 per share and sell for strike price [10]. When the news of the fourth largest bank Lehman Brothers went bankrupt came out, the dollar currency and the U. S. stock index futures was declined at the same time, this indicated that the New York stock market crash in the open market. In order to prevent the open market crash of Lehman Brothers, the U. S. Treasury and the Federal Reserve System made great effort on three d ays to save markets. The investment bank Barclays and Bank of America exited.The Britain's third largest bank Barclays decided to drop out after the government refused to provide financial guarantees to save Lehman Brothers. Then, the bank of America all announced exit the action. Because the government refused to help and no other support, Lehman Brothers final decided to file for bankruptcy protection caused by suffered serious financial crisis[6]. As we can see, there are many factors caused bankruptcy of Lehman Brothers, such as market changes and instability led to systematic risks, the internal problems and risks from Lehman Brothers.The internal problem is one of the most important factors to cause it collapse. As the fourth largest investment bank in the United States, Lehman Brothers more focused on the traditional investment business such as underwriting securities, mergers and acquisitions for a long term. With the rapid development of financial derivatives and fixed inco me products trading, Lehman Brothers strived to expand these businesses and achieved great success. The real estate and credit business develop rapidly after 2000, Lehman Brothers began to involve in these business as other banks [6].However, Lehman Brothers expanded too fast and even in the decline of real estate market in 2007, the commercial real estate bonds of Lehman Brothers still grown quickly. Thus, the rapid growth created more systematic risks for Lehman Brothers. In addition, Lehman Brothers was different from other investment banks like JP Morgan Chase, Bank of America because Lehman had less own capital and its capital adequacy ratio is too low [6]. In order to collected funds to expand business, Lehman had to rely on the bond market and bank lending market.The greater is the leverage ratio when the company borrowing more money from banks, but it has less equity capital. The profit is amplified by the leverage ratio when it makes money, but the loss is enlarging with th e leverage ratio when the company has loss. The lack of funds would be increase the risks for the company when it loss. Moreover, to analyzed the problem of Lehman Brothers’ collapse, it also should be related with the U. S. subprime mortgage crisis and recent financial turmoil intensified from the summer of 2007. In addition, it also considered about the problem of insolvent.Lehman Brother had more than $600 billion bank loans, $155 billion debt securities, and only $639 billion net assets [8]. Besides, the U. S. government took non-interventionism accelerated collapse of Lehman Brothers. As the U. S. government did not make any financial support or warranty to save Lehman Brothers, and leave the market accept the news of the Lehman bankruptcy. The government refused to guarantee Lehman Brothers directly caused many investors to exited, while the Barclays preferred to acquire part of Lehman’s investment business in the United States, this still not strong enough to sa ve Lehman Brothers.Furthermore, the financial markets turmoil around the world should be affect Lehman Brothers, and it also one of a reason affect many companies to left Lehman stocks and bonds whether the U. S. financial institutions or foreign enterprises. Since the market got the news of Lehman Brothers bankruptcy, the Dow Jones Index has dropped nearly 800 points [7]. In short, Lehman Brothers bankruptcy caused the devaluation of investment, cash flow problems and additional losses. Also Lehman financial crisis had a great influence on investors’ directions.Many investors worried about Lehman crisis would be exacerbated the financial crisis and the market prospect is gloomy. Therefore, the Wall Street investment bank Lehman Brothers was collapse in the financial tsunami of 2008. Then on March, 2012, it completed the bankruptcy reorganization and will be to repay debts to creditors. After that, the fourth largest investment bank of the United States has become a historica l. The bankruptcy of Lehman Brothers might impact the entire financial market, the investors worried about the outlook of the U. S. economic and the international oil rices continued to decline. And the investors also concerned that the demand of crude oil and other commodities is likely to fall under the shadow of global recession. At the same time, the risk aversion awareness prompted investors to sell commodities and high risk assets. The U. S. stocks sharply down and European stock markets also had a significant decline. The event of Lehman Brothers gave to the world economic recovery to cast more dark shadows in 2008. References [1] Lehman Brothers Collection. Harvard Business School. Baker Library. Retrieved from http://www. ibrary. hbs. edu/hc/lehman/history. html [2] Sean Hinton. Lehman Brothers (LEHMQ). Wikinvest. Retrieved from http://www. wikinvest. com/stock/Lehman_Brothers_%28LEHMQ%29 [3] Landon Thomas Jr. (July 23, 2003). Market Place; Lehman to Buy Neuberger Berman Fo r $2. 6 Billion. The New York Times. Retrieved from http://www. nytimes. com/2003/07/23/business/market-place-lehman-to-buy-neuberger-berman-for-2. 6-billion. html [4] Lehman Bros files for bankruptcy. (September 16, 2008). Retrieved from http://news. bbc. co. uk/2/hi/business/7615931. stm [5] Lehman Brothers Holdings, Inc.Spector Roseman Kodroff & Willis. Retrieved from http://www. srkw-law. com/areas-of-practice/international/lehman-brothers. html [6] Luigi Zingales. (October 2008). Causes and Effects of the Lehman Brothers Bankruptcy. Retrieved from http://www. scribd. com/doc/11096014/Causes-and-Effects-of-the-Lehman-Brothers-Bankruptcy [7] Lehman Brother. Retrieved from http://en. wikipedia. org/wiki/Lehman_Brothers [8] Kim Sarro & Justin Pak. (November 29, 2008). The Causes for the Collapse of Lehman Brothers Holdings Inc. Retrieved from http://www. articlesbase. om/business-articles/the-causes-for-the-collapse-of-lehman-brothers-holdings-inc-664202. html [9] Lehman Brothers: The last empire of wealth. (December 6, 2011). Retrieved from http://www. stockmarkettoday. cc/lehman-brothers-the-last-empire-of-wealth. html [10] What Happens To Options During Bankruptcy. Option Trading Pedia. Retrieved from http://www. optiontradingpedia. com/what_happens_to_options_during_bankruptcy. htm [11] Hedge funds post biggest losses since Lehman. (June 2010). Retrieved from http://connection. ebscohost. com/c/articles/52970726/hedge-funds-post-biggest-losses-since-lehman

WRITE A PLAN HOW YOU WOULD POSITION YOURSELF FOR VICE PRESIDENT HUMAN Essay

WRITE A PLAN HOW YOU WOULD POSITION YOURSELF FOR VICE PRESIDENT HUMAN RESOURCE - Essay Example The Human Resources Department is tasked with specific functions to carry out its objectives. In order to perform these functions well, its personnel should possess the necessary qualifications, most especially, the person leading them – the vice president for human resources. It is in this regard that this essay is written to present a plan for the position of vice president for human resources in a particular organization. The plan would entail presenting the general scope of responsibilities and further detailing the specific roles and responsibilities of a vice president for human resources. In addition, the mission and vision of the department would be identified to present the focus or objective of the department and identify the department’s strategy to attain organizational goals. According to Wytenburg, â€Å"the Vice President of Human Resources/HR Director is responsible for establishing the company’s personnel base (employed and otherwise) and ensuring this base is adequate and appropriate to its strategic and operational needs. This role will often involve such things as career coaching and organizational development, leadership planning and development, and the planning and delivery of training and education.† As the Vice President for Human Resources, the scope of the responsibilities encompasses five functions: job organization and information, acquisition or recruitment of personnel, maintenance, development and research on human resources. The vice president is tasked to supervise, control, and direct the overall implementation of personnel policies while his or her managers and staff takes care of specialized personnel functions. The specific and technical duties of a vice president are complex and multifarious in terms of performing general management functions in relation to top management and to the human resources department personnel. The detailed responsibilities of the position require

Poor and Minorities in the Criminal Justice System Essay

Poor and Minorities in the Criminal Justice System - Essay Example 190). Observations and importance: For a considerably long time, in the US two different types of criminal justice systems are active. One is for the white and rich people and the other one is for the poor minority people. These were the findings of judges, attorneys, and law professors. They have found that there are inequalities, disparities, and injustices in the treatment of crimes according to races and social, political, and financial power. Different government criminal agencies, courts, and police are highly biased in respect to justice. Sometimes courts take only few minutes to finish the hearing of the case for the minority people, without even considering all the possible aspects and witnesses’ statements. Sometimes the hearing of a poor black person is attended by a white jury, who is naturally supposed to be highly biased against the black community (Cole, 1999, p. 190). All these affect negatively the large number of poor and minority people living in the country . But the most striking feature of the problem is that the law of the US does not allow court and police to be biased against any race and community. This has been rather a social tradition that has been going on and on for a long time. The problem is immensely serious in the sense that these decisions of invoking bias in the criminal justice systems are creating anger and passion for revenge and feelings of social discrimination among the poor and minor people living there. This is also violating the social peace in the country. Evidence shows that a black judge has announced punishment for a white without even completing the hearing, just because the judge has in mind the history of justice system regarding the bias for whites (Banks, 2004, p. 60). It is also shown that for the same crime a black gets more punishment compared to a white. Sometimes the racial discriminations become larger than the financial discriminations. There are also some evidences that reveal that discriminat ions are available in questions like who will be arrested and who will enter into the system, but not in the judgment of terms of sentencing. There are lots of informal sources of discriminations like police and local courts. In the presence of these informal sources it is evident that the African Americans are the most discriminated ethnic society living in the US. The dangerousness or the seriousness of the crime gets more importance for the blacks than for the whites (Bank, 2004, pp. 60-61). Discriminations are also shown in case of the jury selection (Bank, 2004, p. 62) and giving death penalty (Bank, 2004, p. 67). The massacre of 9/11 has created new disparities for the Muslims around the world, especially for the Asian Muslims. Even American people think that there are discriminations against poor and minorities (Greenhouse, 1999). Reasons: There are various reasons for discriminations in criminal justice systems in the US. Most of the reasons are completely social and convent ional and have least or no resemblance with the law or the rules and regulations of the system. For instance, the police may arrest a person completely based on the kind of respect the person shows to the police. A lower respect for the police increases the probability of getting

Critical Case Study Exploration by Using Gibbs Model Essay

Critical Case Study Exploration by Using Gibbs Model - Essay Example 3). On top of the sustained practice, it is also necessary to avoid relying on a single learning strategy. For instance, a student can incorporate both visual and verbal methods in learning. Student can hold discussions with fellow students thus brainstorming what they have learned in class (Davis 2009, p. 21). Studies have exposed the significance of discussing with fellow students what one has learned in class. The last but not least strategy that can improve the failing student’s performance is the incorporation of practical sessions in the syllabus. It is impractical for a student to attain success by holding to the effective learning strategies only. Therefore, alongside such strategies, it is requisite for teachers to devise effective teaching strategies for purposes of augmenting the student’s performance. The Constructivist teaching is one of the current teaching strategies allowing students to examine what they are familiar with, thus making knowledgeable decis ions on the learning content. Moreover, the inclusion of some practical lessons in teaching is crucial, in enhancing a student’s understanding of the course content. This section will utilize Gibbs (1998) reflective model to answer some questions related to the case study. For instance, the first question demands that I identify my thoughts and feelings from the given case study. It is apparent that the student’s performance in the placement has tremendously declined. Prior to commencement of the program, I had a strong feeling that she would depict a high level of understanding for the subject. The result of my thought would be because she seemed kind and caring for patients. However, after the program commences, it is clear that I am totally mistaken because of incompetency demonstrated by her (Bulman 2004, P. 2). Therefore, her inefficiency in whatever she engages herself in makes me think of the possibility of poor learning and teaching practices. Her inability to prioritize the patients’ needs has shown her high level of incompetency. For instance, the student’s inability to relate the class theory to the practical is a clear indication of ineffective teaching, as well as learning methods. In my scrutiny, the student nurse ought to take their class work serious thus depicting a high level of competency in class work. Therefore, the case study indicated that nursing students did not dedicate their efforts to learning. I thus propose that, for an effective performance, the instructors ought to integrate teaching strategies that allow for the student’s active participation. The main reason behind the declined level of incompetence is due to the standardized examinations, which students must sit for in determining the level of qualification. Sources have shown that, it is only after a nursing student excels in such exams that they attain the acquiescence to deal with patients. Those who fail to excel in such exams ought to r etake them until their verification by the authorities. The literature also illustrates the issue of nursing incompetence in the stagnated, as well as the developing countries. Poor teaching strategies are the main causes of the decline in performance. Furthermore, the policy that aids in the examination of nursing qualification is erroneous thus a high level of ineptitude (Iyer 2001, p. 4). Therefore, the concerned authorities have implemented strategies